NTF4 | bioCADDIE Data Discovery Index
Mountain View
biomedical and healthCAre Data Discovery Index Ecosystem
help Advanced Search
Displaying 20 of 296 results for "NTF4"
i
  1. Reprogramming of two somatic nuclei in the same ooplasm leads to pluripotent embryonic stem cells ArrayExpress

    ID: E-GEOD-36468

    Description: tion development and the derivation of tetraploid NT embryonic stem cells (tNT-ES cells). These cells are unique in that they embody the first case of cloned ES cells containing two reprogrammed somatic genomes at the same time and exhibit characteristics of true pluripotency. By assessing allelic expression of Oct4 in normal and double nucleus transplanted embryos throughout development we demonstrate that oocyte mediated reprogramming is embarked with...

  2. Transcription profiling of mouseWT vs CD137L-/- GC B cells ArrayExpress

    ID: E-NCMF-29

    Description: with 50 µg chicken gamma- globulin conjugated to 4-hydroxy-3-nitrophenylacetyl (NP-CG) in alum or infected intranasally with 25 hemagglutinin units of influenza virus strain A/NT/60/68 in 50 µl HBSS. Nine days after immunization or in...

  3. Slug-dependent upregulation of L1CAM is responsible for the increased invasion potential of pancreatic cancer cells following long-term 5-FU-treatment ArrayExpress

    ID: E-GEOD-58386

    Description: typical reason for death after cancer diagnosis. 5-Fluorouracil (5-FU) is the main chemostatic used in first line therapy. However the majority of the tumors become resistant to treatment. To investigate acquired 5-FU resistance in pancreatic adenocarcinoma, we established chemoresistant monoclonal cell lines from the Panc03...

  4. Effect of ultradian light-dark cycles on the transcriptome of mice carying a human Per3 polymorphism ArrayExpress

    ID: E-GEOD-55495

    Description: ariable-number tandem-repeat (VNTR) polymorphism (4 or 5 repeats 54 nt in length) in the circadian gene PER3 is associated with differences in sleep timing and homeostatic re...

  5. Genome-wide Analysis Reveals Mecp2-dependent Regulation of MicroRNAs in a Mouse Model of Rett Syndrome (high-throughput sequencing) OmicsDI

    ID: E-GEOD-24320

    Date Released: 06-26-2012

    Description: ion (UTR) of messenger RNA encoding Brain-derived neurotrophic factor (Bdnf) can be targeted by multiple miRNAs aberrantly up-regulated in absence of Mecp2. Taken together, these results suggest that dys-regulation of miRNAs may contribute to RTT pathoetiology, and also provide a valuable resource to further investigate the role of miRNAs in RTT. Two pooled total RNA samples (4 pairs of wild-type (WT) and Mecp2-null (KO) male mice; postnatal 6-week, the pre-/early-symptomatic stage) were sequenced in a multiplexed configuration (with distinct barcode sequences). And, six samples (two litters, one WT and two KO male mice in each litter; postnatal 8-week, the symptomatic stage) were sequenced individually....

  6. Antisense Transcripts Impede Uridylation-induced Exonucleolytic Degradation to Generate Guide RNAs BioProject

    ID: PRJNA290850

    Keywords: Transcriptome or Gene expression

    Access Type: download

    dataset.description: editing in mitochondria of trypanosomes maintain 5′ triphosphate characteristic of transcription start site and possess U-tail indicative of 3′ processing and uridylation. Here, we identified a protein complex composed of RET1 TUTase and 3′-5′ DSS1 exonuclease, and three additional subunits. This complex, termed mitochondrial ...
  7. Effect of 12 hour sleep restriction on the transcriptome of mice carying a human Per3 polymorphism ArrayExpress

    ID: E-GEOD-55494

    Description: ariable-number tandem-repeat (VNTR) polymorphism (4 or 5 repeats 54 nt in length) in the circadian gene PER3 is associated with differences in sleep timing and homeostatic re...

  8. 169 Metabolomics

    Study Name: Comprehensive analysis of transcriptome and metabolome analysis in Intrahepaticand Hepatocellular Carcinoma

    Grant ID: U01 DK097430-01

    study.location: 1-4-3, asahimachi, Abeno-ku, Osaka 545-85, Osaka Japan1-4-3, asahimachi, Abeno-ku, Osaka 545-85, Osaka Japan
  9. DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing ArrayExpress

    ID: E-GEOD-21159

    Description: rate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. The described assay outputs absolute copy number, outputs an error estimate (p-value), and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitoch...

  10. PRJEB6759 BioProject

    Keywords: Other

    Access Type: download

    dataset.description: e (on Day 0 and Day 2) before MEFs were collected 4 days post transfection. 20-30 nt small RNAs were gel purified from total RNAs and sequentially ligated to Linker-1 (IDT) and 5' adaptor. The ligated products were amplified with DSFP5 (AATGATACGGCGACCACCGACTATGGATACTTAGTCAGGGAGGACGATGCGG) and Linker 1-RT (CAAGCAGAAGACGGCATACGAATTGATGGTGCCTACAG), and sequenced by Hi-Seq 2000 (Illumina). Raw reads were trimmed from...
  11. Expression data from mouse skin BioProject

    ID: PRJNA139303

    Keywords: Transcriptome or Gene expression

    Access Type: download

    dataset.description: which is not yet been understood. We found that a 5 week-oral administration of WB seed extract inhibited wrinkle formation induced by repeated tape stripping (TS), which is a model of lichenification in human chronic eczematous dermatitis. To elucidate mechanism of ...
  12. Endogenous siRNA and miRNA targets identified by sequencing of the Arabidopsis degradome BioProject

    ID: PRJNA107091

    Keywords: Transcriptome or Gene expression

    Access Type: download

    dataset.description: ut relying on predictions or over-expression. The 5' ends of poly-adenylated, uncapped mRNAs from Arabidopsis were directly sampled resulting in an empirical snapshot of the degradome. miRNA-mediated cleavage products were easily discerned from an extensive background of degraded mRNAs, which collectively covered the majority of the annotated transcriptome. Many previously known Arabidopsis miRNA targets were confirmed and several novel targets were also discovered. Quantification of cleavage fragments revealed that those derived from TAS transcripts, which are unusual in their production of abundant secondary siRNAs, accumulated to very high levels. A subset of second...
  13. Small RNA Solexa sequencing of 4 Plant Species in the Cucurbitaceae family OmicsDI

    ID: E-GEOD-38176

    Date Released: 06-02-2014

    Description: viously. In brief, small RNA fractions of 18–28 nt were isolated from 15% denaturing polyacrylamide gels and sequentially ligated to 5′ and 3′ RNA adapters. Small RNAs ligated with adapters were converted to DNA by RT-PCR following Solexa protocol. The final PCR product was gel purified and sequenced by Genome Analyser II (Illumina). Examination of small RNA transcriptomes in four plants species using Illumina/Solexa GA-II....

  14. A small RNA response to DNA ends in Drosophila ArrayExpress

    ID: E-GEOD-38967

    Description: ndently of the exact end structure (blunt, 3'- or 5'-overhang), can repress homologous sequences in trans and may therefore - in addition to putative roles in repair - exert a quality control function by clearing potentially truncated messages from genes in the vicinity of the break. Drosophila melanogaster S2 cells were cultured and transfected with reporter gene plasmids that were either circular or modified by restriction digest prior to transfection. Following transfection, total RNA was isolated from the cells and gel-purified for size selection (~18-30 nt). Digested plasmid samples were compared to those of circular plasmids and a nontransfected control....

  15. Transcriptional network analysis reveals that AT1 and AT2 Angiotensin II receptors are both involved in the regulation of genes essential for glioma p... OmicsDI

    ID: E-GEOD-47529

    Date Released: 01-03-2015

    Description: d by the significant genes were ErbB, mTOR, MAPK, neurotrophin, insulin and Wnt. Finally, interactome analyses revealed hub genes associated with cell proliferation, survival, migration, transport, structural support, neurotrophin pathway, MAPK signaling and Wnt signaling. Taken together, our findings implicate Ang II-transcriptional regulation in glioma progression by means of the modulation of genes participating in protumoral functions. This transcriptome pattern is observed upon Ang II activation of either AT1 or AT2 receptors, thereby highlighting the relevance of both receptor subtypes in glioma progression. Interactome analyses disclosed hub genes regulated by Ang II which may present higher control over their networks. These genes participate in biological functions that could enhance the degree of malignancy in gliomas and thus should be further explored. C6 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 Units/ml penicillin and 100 µg/ml streptomycin. Cells were seeded in cell culture dishes and incubated at 37°C/ 5% CO2 until becoming confluent. Then, these cells were pre-treated (30 minutes) with either AT1 receptor antagonist (Losartan: 10-5M) or AT2 receptor antagonist (PD123319: 10-5M) followed by Ang II treatment (10-7 M) according to the treatment scheme: Group 1 – control; Group 2 – cells only treated with Ang II; Group 3 – cells pre-treated (30 minutes) with Losartan and then treated with Ang II; Group 4 – cells pre-treated (30 minutes) with PD123319 and then treated with Ang II. ...

  16. Transcription profiling by array of mouse dorsal skin after tape stripping and treatment with winged bean extract. OmicsDI

    ID: E-GEOD-28477

    Date Released: 04-30-2015

    Description: which is not yet been understood. We found that a 5 week-oral administration of WB seed extract inhibited wrinkle formation induced by repeated tape stripping (TS), which is a model of lichenification in human chronic eczematous dermatitis. To elucidate mechanism of ...

  17. Transcriptome analysis of Dunaliella viridis in response to changes in light duration and temperature OmicsDI

    ID: E-GEOD-40997

    Date Released: 05-02-2015

    Description: mperature Time course experiment experiment with 5 evenly spaced time points, t1-t5, and two experimental factors: a) light condition (2 levels: continuous light and light/dark cycle) and b) temperature (2 levels: 25 degrees Celsius and 35 degrees Celsius). Cells grown in...

  18. A pioneer protein encoded by required to maintain repression2 facilitates locus-specific paramutation in Zea mays OmicsDI

    ID: E-GEOD-37204

    Date Released: 03-11-2013

    Description: the Pl1-Rhoades haplotype, for accumulation of 24 nt RNA species, and for maintenance of a 5-methylcytosine pattern distinct from that maintained by RNA polymerase IV. Genetic tests indicate that RMR2 is not required for paramutation occurring at the red1 locus. These results distinguish the paramutation-type mechanisms operating at specific haplotypes. The RMR2 clade of proteins provides a new entry point for understanding the diversity of epigenomic control o...

  19. Genome-wide analysis for rice small RNAs by MPSS OmicsDI

    ID: E-GEOD-10523

    Date Released: 05-02-2014

    Description: Small RNAs (21-24 nt) are involved in gene regulation through translation inhibition, mRNA cleavage, or directing chromatin modifications. In rice, c...

  20. Modified iCLIP sequencing of HeLa cells with antibody eIF4A3 - additional 5' adapter ligation ArrayExpress

    ID: E-MTAB-4000

    Description: ATP (1mM), 0.4 l 10x PNK buffer, 3 l water) and a 5 marker ligation (6 l water, 5 l 4X ligation buffer, 2 l RNA ligase, 1 l RNasin, 2 l 5 marker (100 M), 4 l PEG400). The sequence of the 5 marker is CAGUCCGACGAUC, which corresponds to the Illumina short RNA 5 Adapter (RA5), part #15013205; this sequence is not complementary to the primers used for amplification of iCLIP cDNA libraries (Huppertz et al., 2014). We then produced sequence reads of 120 nt using the Illumina HiSeq platform for eIF4A3 iCLIP. The rest of the protocol was carried out as previously described (Huppertz et al., 2014). Huppertz, I., Attig, J., D'Ambrogio, A., Easton, L.E., Sibley, C.R., Sugimoto, Y., Tajnik, M., Konig, J., and Ule, J. (2014). iCLIP: protein-RNA interactions at nucleotide resolution. Methods 65, 274-287....


Displaying 20 of 296 results for "NTF4"