TCP10L | bioCADDIE Data Discovery Index
Mountain View
biomedical and healthCAre Data Discovery Index Ecosystem
help Advanced Search
Displaying 20 of 89 results for "TCP10L"
i
  1. The PIAS-like coactivator Zmiz1 directly and selectively coregulates Notch1 in T-cell development and leukemia [RNA-Seq] BioProject

    ID: PRJNA275967

    Keywords: Transcriptome or Gene expression

    Access Type: download

  2. The PIAS-like coactivator Zmiz1 directly and selectively coregulates Notch1 in T-cell development and leukemia [RNA-Seq] ArrayExpress

    ID: E-GEOD-66145

    Description: The most recurrently mutated oncogene in T-cell acute lymphoblastic leukemia (T-ALL) is NOTCH1. The core Notch complex consists of an ...

  3. Comparison of gene expression profiles of HIV-specific CD8 T cells from controllers and progressors BioProject

    ID: PRJNA133651

    Keywords: Transcriptome or Gene expression

    Access Type: download

  4. TCP1L_PANTR UniProt:Swiss-Prot

    ID: Q68US1

    Description: T-complex protein 10A homolog 2 Leucine-zipper

  5. The PIAS-like coactivator Zmiz1 directly and selectively coregulates Notch1 in T-cell development and leukemia [RNA-Seq] OmicsDI

    ID: E-GEOD-66145

    Date Released: 12-08-2015

    Description: The most recurrently mutated oncogene in T-cell acute lymphoblastic leukemia (T-ALL) is NOTCH1. The core Notch complex consists of an ...

  6. Comparison of gene expression profiles of Jurkat cells with or without PD-1 ligation BioProject

    ID: PRJNA133219

    Keywords: Transcriptome or Gene expression

    Access Type: download

    dataset.description: CD8+ T cells in chronic viral infections like HIV develop functional defects such as loss of IL-2 secretion and decre...
  7. NOTCH1/RBPJ complexes drive target gene expression through dynamic interactions with super-enhancers BioProject

    ID: PRJNA225097

    Keywords: Epigenomics

    Access Type: download

    dataset.description: The main oncogenic driver in T-lymphoblastic leukemia (T-LL) is NOTCH1, which activates genes by forming chromatin-associated Notch transcrip...
  8. Crystal structure of an iNKT TCR in complex with CD1d-lysophosphatidylcholine PDB

    ID: PDB:3TZV

    Description: Invariant Natural Killer T Cell Receptor chain A, Invariant Natural Killer T Cell Receptor chain B, Antigen-presenting glycoprotein CD1d,...

  9. LIGANDED STEROL CARRIER PROTEIN TYPE 2 (SCP-2) LIKE DOMAIN OF HUMAN MULTIFUNCTIONAL ENZYME TYPE 2 (MFE-2) PDB

    ID: PDB:1IKT

    Description: ESTRADIOL 17 BETA-DEHYDROGENASE 4, OXTOXYNOL-10

  10. Population genomics of Trypanosoma cruzi DTU-I : Population genomics of Trypanosoma cruzi DTU-I clade from different locations of America BioProject

    ID: PRJEB14443

    Keywords: Other

    Access Type: download

    dataset.description: oplastidae protozoan with a dual life cycle and a complex genome, is the causative agent of Chagas’ disease, a severe and debilitating neglected tropical disease affecting almost 10 mill...
  11. Tetrahymena thermophila : A ciliated unicellular freshwater eukaryote BioProject

    ID: PRJNA12563

    Access Type: download

    dataset.description: ater organism inhabits streams, lakes, and ponds. Like other ciliates, Tetrahymena cells have a complex genome structure. Each cell contains a diploic micronucleus (mic) and a somatic macronucleus (mac). The two nuclei function independ...
  12. To identify genes that are modulated in keratinocytes in response to wounding ArrayExpress

    ID: E-GEOD-31926

    Description: Dendritic epidermal T cells (DETC) reside in murine skin and participate in homeostasis and wound repair. Upon wounding, DETC become activated through...

  13. Crystal structure of Sulfolobus shibatae isopentenyl diphosphate isomerase in complex with reduced FMN and IPP. PDB

    ID: PDB:2ZRY

    Description: Isopentenyl-diphosphate delta-isomerase (E.C.5.3.3.2)

  14. Crystal structure of Sulfolobus shibatae isopentenyl diphosphate isomerase in complex with reduced FMN. PDB

    ID: PDB:2ZRV

    Description: Isopentenyl-diphosphate delta-isomerase (E.C.5.3.3.2)

  15. Crystal structure of Bcl-xL in complex with compound 10 PDB

    ID: PDB:3WIZ

    Description: Bcl-2-like protein 1

  16. Crystal structure of Sulfolobus shibatae isopentenyl diphosphate isomerase in complex with reduced FMN and DMAPP PDB

    ID: PDB:2ZRZ

    Description: Isopentenyl-diphosphate delta-isomerase

  17. COMPLEX BETWEEN DNA AND THE DNA PHOTOLYASE FROM ANACYSTIS NIDULANS PDB

    ID: PDB:1TEZ

    Description: Deoxyribodipyrimidine photolyase (E.C.4.1.99.3)/DNA complex

  18. Single-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specificati... ArrayExpress

    ID: E-GEOD-61189

    Description: ing sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genom...

  19. Crystal structure of Sulfolobus shibatae isopentenyl diphosphate isomerase in complex with oIPP. PDB

    ID: PDB:3B04

    Description: Isopentenyl-diphosphate delta-isomerase (E.C.5.3.3.2)

  20. GABARAP-L1 ATG4B LIR Complex PDB

    ID: PDB:5LXH

    Description: Gamma-aminobutyric acid receptor-associated protein-like 1, Cysteine protease ATG4B (E.C.3.4.22.-)


Displaying 20 of 89 results for "TCP10L"