BIN2 | bioCADDIE Data Discovery Index
Mountain View
biomedical and healthCAre Data Discovery Index Ecosystem
help Advanced Search
Displaying 18 of 18 results for "BIN2"
i
  1. Crystal structure of the N-BAR domain of human bridging integrator 2. PDB

    ID: PDB:4AVM

    Description: BRIDGING INTEGRATOR 2

  2. Crystal Structure of hBRAP1 N-BAR domain PDB

    ID: PDB:4I1Q

    Description: Bridging integrator 2

  3. BIN2_MOUSE UniProt:Swiss-Prot

    ID: D3Z6Q9

    Description: Bridging integrator 2 BAR Ser-rich Phosphoserine Phosphoserine Phosphoserine Phosphoserine Ph...

  4. BIN2_RAT UniProt:Swiss-Prot

    ID: Q68FR2

    Description: Bridging integrator 2 BAR Poly-Ser Glu-rich Poly-Pro Phosphoserine Phosphoserine Phosphoserin...

  5. M2K4_ARATH UniProt:Swiss-Prot

    ID: O80397

    Description: D-230 or E-230 Abolishes phosphorylation by ASK7/BIN2 Constitutively active; when associated with D-224 Constitutively active; when associated with D-224 Abolishes phosphorylation by ASK7/BIN2 Abolishes activity of MKK4 against MPK6...

  6. BIN2_CHICK UniProt:Swiss-Prot

    ID: Q5ZKL7

    Description: Bridging integrator 2 BAR Pro-rich

  7. Bifidobacterium asteroides strain:Bin2 : Bifidobacterium asteroides strain:Bin2 Genome sequencing and assembly BioProject

    ID: PRJNA257133

    Keywords: Genome sequencing and assembly

    Access Type: download

    organism.strain: Bin2
  8. Transcription profiling by array of Arabidopsis mutant for arf2 after treatment with brassinazole ArrayExpress

    ID: E-GEOD-11216

    Description: hesis. Together, these data suggest a model where BIN2 increases expression of auxin-induced genes by directly inactivating repressor ARFs, leading to synergistic increases in transcription. Experiment Overall Design: Total RNA was extracted from 4-day-old, etiolated Arabidopsis seedlings grown on 0.5 µM BRZ or mock treatments and used to probe ATH1 microarrays (Affymetrix), according to manufacturer’s protocols. There are three independent biological replicates for each genotype and treatment, except for arf2 mutants with BRZ where only two arrays passed quality control. We performed standard Affymetrix quality-control procedures using the BioConductor packages simpleaffy. Expression was normalized and estimated using the gcRMA packa...

  9. The crystal structure of the BAR domain from human Bin1/Amphiphysin II and its implications for molecular recognition PDB

    ID: PDB:2FIC

    Description: bridging integrator 1

  10. BIN1_RAT UniProt:Swiss-Prot

    ID: O08839

    Description: Removed Myc box-dependent-interacting protein 1 BAR SH3 Interaction with BIN2 Clathrin-binding N-acetylalanine Phosphoserine Phosphoserine Phosphoserine Phosp...

  11. Brassinazole treatment of arf2 and wild-type dark-grown seedlings BioProject

    ID: PRJNA106821

    Keywords: Transcriptome or Gene expression

    Access Type: download

    dataset.description: hesis. Together, these data suggest a model where BIN2 increases expression of auxin-induced genes by directly inactivating repressor ARFs, leading to synergistic increases in transcription. Keywords: arf2 vs. Col, BRZ vs. mock Overall design: Total RNA was extracted from 4-day-old, etiolated Arabidopsis seedlings grown on 0.5 µM BRZ or mock treatments and used to probe ATH1 microarrays (Affymetrix), according to manufacturer’s protocols. There are three independent biological replicates for each genotype and treatment, except for arf2 mutants with BRZ where only two arrays passed quality control. We performed standard Affymetrix quality-control procedures using the BioConductor packages simpleaffy. Expression was normalized and estim...
  12. Drug tolerance development of mouse Bcr/Abl pre-B ALL cells on irradiated MEFs ArrayExpress

    ID: E-GEOD-37286

    Description: d two different pre-B ALL cell lines 8093 and Bin-2, derived from two BCR/ABL transgenic mice. 8093 is a leukemia on an inbred f11 C57Bl/6J background whereas Bin2 was derived from ALL on a mixed genetic background. Each was treated with the tyrosine kinase inhibitor nilotinib = AMN107 (20 nM for 8093, 50 nM for Bin-2, abbreviated with nil or n) or with the farnesyltransferase inhibitor (FTI) Lonafarnib/SCH66336 (1 mM for 8093, 0.25 mM for Bin-2; abbreviated with lon or l) in the presence of an irradiated mouse embryonic fibroblast feeder layer. Cells loosely attached to the top of the feeder layer or present in the medium were harvested for RNA isolation. Except where noted, all samples were taken in biological triplicates (separate plates). Samples were taken at t=0 (begin/start); on day 3 for Bin-2 (nil and lon) when the viability was 5-10% based on Trypan blue exclusion, on d4 for 8093 (lon, viability 20%) or d3 (nil, 5-10% viability) at the midpoint when cells start to develop resistance, and on d30 (Bin-2 x lon), d21 (Bin-2 x nil), d26 (8093 x lon) and d 20 (8093 x nil) when the viability of the culture was completely restored (around 90%...

  13. Transcription profiling by array of Arabidopsis mutant for arf2 after treatment with brassinazole OmicsDI

    ID: E-GEOD-11216

    Date Released: 04-29-2015

    Description: hesis. Together, these data suggest a model where BIN2 increases expression of auxin-induced genes by directly inactivating repressor ARFs, leading to synergistic increases in transcription. Experiment Overall Design: Total RNA was extracted from 4-day-old, etiolated Arabidopsis seedlings grown on 0.5 µM BRZ or mock treatments and used to probe ATH1 microarrays (Affymetrix), according to manufacturer’s protocols. There are three independent biological replicates for each genotype and treatment, except for arf2 mutants with BRZ where only two arrays passed quality control. We performed standard Affymetrix quality-control procedures using the BioConductor packages simpleaffy. Expression was normalized and estimated using the gcRMA packa...

  14. Molecular architecture of the eukaryotic chaperonin TRiC/CCT derived by a combination of chemical crosslinking and mass-spectrometry, XL-MS PDB

    ID: PDB:4V94

    Description: T-complex protein 1 subunit zeta, T-complex protein 1 subunit theta, T-complex protein 1 subunit eta, T-complex...

  15. The crystal structure of yeast CCT reveals intrinsic asymmetry of eukaryotic cytosolic chaperonins PDB

    ID: PDB:4V81

    Description: T-complex protein 1 subunit alpha, T-complex protein 1 subunit beta, T-complex protein 1 subunit gamma, T-compl...

  16. Drug tolerance development of mouse Bcr/Abl pre-B ALL cells on irradiated MEFs BioProject

    ID: PRJNA159405

    Keywords: Transcriptome or Gene expression

    Access Type: download

    dataset.description: d two different pre-B ALL cell lines 8093 and Bin-2, derived from two BCR/ABL transgenic mice. 8093 is a leukemia on an inbred f11 C57Bl/6J background whereas Bin2 was derived from ALL on a mixed genetic background. Each was treated with the tyrosine kinase inhibitor nilotinib = AMN107 (20 nM for 8093, 50 nM for Bin-2, abbreviated with nil or n) or with the farnesyltransferase inhibitor (FTI) Lonafarnib/SCH66336 (1 mM for 8093, 0.25 mM for Bin-2; abbreviated with lon or l) in the presence of an irradiated mouse embryonic fibroblast feeder layer. Cells loosely attached to the top of the feeder layer or present in the medium were harvested for RNA isolation. Except where noted, all samples were taken in biological triplicates (separate plates). Samples were taken at t=0 (begin/start); on day 3 for Bin-2 (nil and lon) when the viability was 5-10% based on Trypan blue exclusion, on d4 for 8093 (lon, viability 20%) or d3 (nil, 5-10% viability) at the midpoint when cells start to develop resistance, and on d30 (Bin-2 x lon), d21 (Bin-2 x nil), d26 (8093 x lon) and d 20 (8093 x nil) when the viability of the culture was completely restored (around 90% viability), and...
  17. Systematic investigation of transcription factor activity in the context of chromatin using massively parallel DNA binding and expression assays BioProject

    ID: PRJNA357133

    Keywords: Other

    Access Type: download

    dataset.description: bins 5’ primers: Bin1 AACGAGGGACCAGGTGCCGTAAC Bin2 GCATAGGGACCAGGTGCCGTAAC Bin3 AGATAGGGACCAGGTGCCGTAAC Bin4 GAGTAGGGACCAGGTGCCGTAAC Bin5 TCGTAGGGACCAGGTGCCGTAAC Bin6 CTGTAGGGACCAGGTGCCGTAAC Bin7 TATTAGGGACCAGGTGCCGTAAC Bin8 CGTTAGGGACCAGGTGCCGTAAC Bin9 ACGAAGGGACCAGGTGCCGTAAC Bin10 TAAGCGGGACCAGGTGCCGTAAC Bin11 TTATCGGGACCAGGTGCCGTAAC Bin12 TACTCGGGACCAGGTGCCGTAAC Bin13 CATTCGGGACCAGGTGCCGTAAC Bin14 CCTAAGGGACCAGGTGCCGTAAC Bin15 GCAATGGGACCAGGTGCCGTAAC Bin16 CTACAGGGACCAGGTGCCGTAAC Bin1 ACTATGGGACCAGGTGCCGTAAC Bin2 TACCAGGGACCAGGTGCCGTAAC Bin3 CAAGTGGGACCAGGTGCCGTAAC Bin4 TGAGTGGGACCAGGTGCCGTAAC Bin5 ATAGTGGGACCAGGTGCCGTAAC Bin6 AAGGTGGGACCAGGTGCCGTAAC Bin7 ATCCAGGGACCAGGTGCCGTAAC Bin8 GATGTGGGACCAGGTGCCGTAAC Bin9 TCTGTGGGACCAGGTGCCGTAAC Bin10 AGTGTGGGACCAGGTGCCGTAAC Bin11 CTTGTGGGACCAGGTGCCGTAAC Bin12 TCATTGGGACCAGGTGCCGTAAC Bin13 AAGCAGGGACCAGGTGCCGTAAC Bin14 CGATTGGGACCAGGTGCCGTAAC Bin15 GTATTGGGACCAGGTGCCGTAAC Bin16 CACTTGGGACCAGGTGCCGTAAC Bin1 ATGTTGGGACCAGGTGCCGTAAC Bin2 CATCAGGGACCAGGTGCCGTAAC Bin3 TCTCAGGGACCAGGTGCCGTAAC Bin4 AGTCAGGGACCAGGTGCCGTAAC Bin5 GTTCAGGGACCAGGTGCCGTAAC Bin6 ACAGAGGGACCAGGTGCCGTAAC Bin7 GTAGAGGGACCAGGTGCCGTAAC Bin8 TTGGAGGGACCAGGTGCCGTAAC Bin9 TGTGAGGGACCAGGTGCCGTAAC Bin10 ATTGAGGGACCAGGTGCCGTAAC Bin11 GACAAGGGACCAGGTGCCGTAAC Bin12 CAATAGGGACCAGGTGCCGTAAC Bin13 TCCAAGGGACCAGGTGCCGTAAC Bin14 AGCAAGGGACCAGGTGCCGTAAC Bin15 CTCAAGGGACCAGGTGCCGTAAC Bin16 CAGAAGGGACCAGGTGCCGTAAC...
  18. Drug tolerance development of mouse Bcr/Abl pre-B ALL cells on irradiated MEFs OmicsDI

    ID: E-GEOD-37286

    Date Released: 09-28-2015

    Description: d two different pre-B ALL cell lines 8093 and Bin-2, derived from two BCR/ABL transgenic mice. 8093 is a leukemia on an inbred f11 C57Bl/6J background whereas Bin2 was derived from ALL on a mixed genetic background. Each was treated with the tyrosine kinase inhibitor nilotinib = AMN107 (20 nM for 8093, 50 nM for Bin-2, abbreviated with nil or n) or with the farnesyltransferase inhibitor (FTI) Lonafarnib/SCH66336 (1 mM for 8093, 0.25 mM for Bin-2; abbreviated with lon or l) in the presence of an irradiated mouse embryonic fibroblast feeder layer. Cells loosely attached to the top of the feeder layer or present in the medium were harvested for RNA isolation. Except where noted, all samples were taken in biological triplicates (separate plates). Samples were taken at t=0 (begin/start); on day 3 for Bin-2 (nil and lon) when the viability was 5-10% based on Trypan blue exclusion, on d4 for 8093 (lon, viability 20%) or d3 (nil, 5-10% viability) at the midpoint when cells start to develop resistance, and on d30 (Bin-2 x lon), d21 (Bin-2 x nil), d26 (8093 x lon) and d 20 (8093 x nil) when the viability of the culture was completely restored (around 90%...


Displaying 18 of 18 results for "BIN2"